EST 910111 is a singleton


Sequence

>910111 (1 EST) Length=176 CCCAAGTTTGAGGTTNAAATTNTAACTTAAGAAAACACGACGTAACNTTTTTTGATGTAAATCGTTTTTATATATCAATA AGTAACCTATTAAGAGGGTAGATCAGACTGCCAGGCAGCACGTATACTCACAGAGTTGTGCACAGCTTCAGAAGCAACAC AGAATCTTAGATGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910111: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101111906176AA269114KJ4SLB041T3JHU93SL-BmL4 (JHU)


Date: 4:29:44 on Wed 22 Nov 117.