EST 910119 is a singleton


Sequence

>910119 (1 EST) Length=186 CCCAAGTTTGAGGTTTTTTTCTTTCAACAATTGGTTTTGGTAGATNGAAAAAGGGTATAAAATTGTAAGAAAGCACAGGN GTNGGTTCCGAGGCACTGAATCCGATCGTTTACCATTCGTTTGCGTCCTAACTGGCGTTACCAATGTGATGATATCGTGT CAGAGGAGGTCAGGAACGCTCCGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910119: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101191906184AA269122KJ4SLB102T3JHU93SL-BmL4 (JHU)


Date: 11:32:26 on Wed 22 Nov 117.