EST 910127 is a singleton


Sequence

>910127 (1 EST) Length=122 CCCAAGTTTGAGGAGTTGTCGAACACCCTACNAAGTCAAAGGCAAACTTATTTATCTCGTGACGTAGTTGCCGTCTCAAG AGTTGATCACTATTATAGTCAATCTTCATCAACCTTNTGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910127: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101271906192AA269130KJ4SLB073T3JHU93SL-BmL4 (JHU)


Date: 18:1:28 on Tue 21 Nov 117.