EST 910129 is a singleton


Sequence

>910129 (1 EST) Length=176 CCCAAGTTTGAGCNNNATCNATNGACATATCNCNCACGCAATGTCNGGCGCAAGGAGGTAAGTAACCNAAAAGCCAAAAG GGACAGAAGGAGCCACTAGGAGGACATGCATCAGGAGAACACAGAGAGCCAGATCGAGCATCGGCAAGCGCCAAGGTCCN NGGGATCAACGCAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910129: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101291906194AA269132KJ4SLB083T3JHU93SL-BmL4 (JHU)


Date: 19:52:33 on Fri 17 Nov 117.