EST 910133 is a singleton


Sequence

>910133 (1 EST) Length=205 AAGAATTAAACTTTTTNNTTTTTAAATAATGACGGAATATCAAANACATACCATTAATGTATAATATATATTNATGATAG AAATGAGGAAGTTAGGCGGAAGAGAAAATATATATCCCTAGTAATAGAAAATAATGCTCCAGTACTACATTCCCTTTTGC CTAGCAGCTCTCAGCTCGATTCTATCAGTCATCATGTCAGCAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910133: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101331906198AA269136KJ4SLB057T3JHU93SL-BmL4 (JHU)


Date: 2:34:37 on Thu 23 Nov 117.