EST 910138 is a singleton


Sequence

>910138 (1 EST) Length=218 ATTCAAGTAANTAACGGCGACTTCAATTATCNNAAAGAATATCAAGACACCAATTCCNATCAAAGAAAGCCTATACTAAA TCAAGTTAGCCTTATAATATGTTCAATGTCATATACGCTTTGGAATAGGTAGGCCTTTGGCTCTAGCGCTATCATCATTG ACTCCTTGATAGAAGATCGTCTCAGTATCTTGTTGAGCTCAGTCTTTATCAGACAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910138: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101381906203AA269096KJ4SLB086T3JHU93SL-BmL4 (JHU)


Date: 13:56:50 on Mon 20 Nov 117.