EST 910139 is a singleton


Sequence

>910139 (1 EST) Length=201 CCCAAGTTTGAGGTCGGATCTAAATAGNNAACTTAAAAAAACCCAGACGNACCATTTTTTGGATGGAAAATGCCGNCTGA CATACGGATAACATAAGTAACCCTATAATAAGGAAGGTAAGGAATCCAGACTCGGCACAGGGCTGGCCTACGTTATGACT CAACAGAAAGGTTGGTGGCAACCAAGCCGATTCAGGAAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910139: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101391906204AA269097KJ4SLB180T3JHU93SL-BmL4 (JHU)


Date: 4:22:50 on Fri 24 Nov 117.