EST 910182 is a singleton


Sequence

>910182 (1 EST) Length=136 CGTTCATCCAAAGGGCCTGGATCATCACCACTAAGACCAGTTGGAAATAGTAATCACTTAATTGCACGTATTTCTGGTGA ATGGAATAAAATTATCAATTTTGAAGTTTTGAATAAGAATTTACATAAATGGTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910182: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101821906247AA269179MA1MR002.AA3S. mansoni adult Lambda Zap


Date: 5:10:59 on Sat 18 Nov 117.