EST 910184 is a singleton


Sequence

>910184 (1 EST) Length=214 GTTTCTCTAATAAGAAAAAACAAACAAACATGTTTAAGTGTTAACTTCAACAATGTAAACAAGAATCCAAATAGTTTAAT TTGTATAAAATACAAATGGTTTATCTTTTACACCGGAAATATATTTAAATTAGAAGACTATATTTTAAACAATAGTTATA GCTATAGTAAATAATAAGAAAAATATATACAAGAATGTTAGAAATTAATAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910184: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101841906249AA269181MA1MR004.AA3S. mansoni adult Lambda Zap


Date: 18:29:2 on Sat 18 Nov 117.