EST 910189 is a singleton


Sequence

>910189 (1 EST) Length=169 GAAACGACAATCAAAATTGAAAGACATCCTTCACCTAATCTTATATCAACAGCACCAATATCACCTGATCATATAACTAC TAATGTGACTGTTCCTGCTAATAATACTACTACTGTTAGTACTTGTTACCACTACTTCTAATACTACAACTAATATTAAT TACAATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910189: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101891906254AA269186MA1MR059.AA3S. mansoni adult Lambda Zap


Date: 15:57:27 on Tue 21 Nov 117.