EST 910191 is a singleton


Sequence

>910191 (1 EST) Length=223 CAAGCGTTCGCTCGCTTGTGCGCTGTGTACGGTGGGACTTATATGCTCAATAAACCGATTGATGAACTAGTGATGGAAAA AGGAAGAGTTGTTGGAGTCAAATCAGATAATAAAATTGCAAAATGTAACATGGTTATTTGTGATCCAAGTTATGTGCGCA CTATGGTAATAAAAGTCGATCAAGTTGTTCGTGCTACTGCATCTGACACATCGATGCGAAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910191: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101911906256AA269188MA1MR011.AA3S. mansoni adult Lambda Zap


Date: 15:30:57 on Fri 24 Nov 117.