EST 910192 is a singleton


Sequence

>910192 (1 EST) Length=177 TACAGTTTGATCTTACTTTTTTCGAGAAAAGAGATTTTGTACATGAAGATAACTAATAGCTTGATTTCATACAAAGGTTT TATCTGATGAAATTCAATAGACAATACTCAATGTCCATGTTGATGAATGTACGTAGCAGAGGAAGACACTATTTACCACT TTTGTCTAATGATCGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910192: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101921906257AA269189MA1MR012.AA3S. mansoni adult Lambda Zap


Date: 14:14:25 on Sat 18 Nov 117.