EST 910194 is a singleton


Sequence

>910194 (1 EST) Length=164 AATAATTATAATAATGAAATATTGAAGAGTGAAAGAAAGAAGGGAAATTCATATTATTATGATAGAAATACAAATGATAA AGCTTCATCTGCCAGTCACAAAGGTGACGAAGTTATAATAATGACAATTATCGAACATCCTATTATGATGATATTAATAT GCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910194: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101941906259AA269191MA1MR014.AA3S. mansoni adult Lambda Zap


Date: 4:46:54 on Sat 25 Nov 117.