EST 910196 is a singleton


Sequence

>910196 (1 EST) Length=122 GTTTCTGTTCTACTTCTAATACTACTACTAATACTAATACTACTTAAATCACTACTATTAAACTTACTTCCATAACTGTT ACTAATACTGCTGTTGGTAGTTACCGTATTTTGCTCTAACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910196: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101961906261AA269193MA1MR057.AA3S. mansoni adult Lambda Zap


Date: 10:10:10 on Fri 24 Nov 117.