EST 910202 is a singleton


Sequence

>910202 (1 EST) Length=236 GAAAAACGTCTAAGAATGTAAATGAATCCTTTTATCTTTCCAATTTAAATTATAAACAAATGAGGAAAATTATTCAAAAT TACTAATTCTGAAGAAAAAGAATAACAGAGAAAATAGTTATCCCAAAATTATTGTGTGATAAGATACACACACGCACACA TAGAAATATGTGTGCCCAATTCATGTCAAATTATCAAAGAAACAATGAATATTATTAAATTTTTTCAAGAAATGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910202: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102021906267AA269199MA1MR022.AA3S. mansoni adult Lambda Zap


Date: 14:30:20 on Tue 21 Nov 117.