EST 910203 is a singleton


Sequence

>910203 (1 EST) Length=238 GTCAATGTAGCTCAAGATGCTAAAGAAAAAGTCGAATCAACAATTTCTGCCATTCGGAATTCAGAGGTTGTGAAATCACT GAATGATAAAGTTGGTTCTGCTTATTCAACAGTTAAAGATGTTATAATTCATTCGACGTATGGACATCCACCAGACGATG GAACTGAATATGTTGGTAATAATAATACCAAGAAATAATGTTAGATTATTATTATTATATTCCAAATTAGCCCGTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910203: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102031906268AA269200MA1MR023.AA3S. mansoni adult Lambda Zap


Date: 4:49:59 on Sat 25 Nov 117.