EST 910205 is a singleton


Sequence

>910205 (1 EST) Length=176 CTTTAATGTTTTAATTTCTCTATGTGTAAATTCATGAAAGAAAAATTGCATTGTAATATCGAACAAGAATTTAATCTTTT TTTTTCTTTTCATACTTATTTATTCTATCAATATTGTGAATAACTAGATAAAATATTAAGAGTCTTTTAATGAGAAATGG GCTTTTTTAATGATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910205: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102051906270AA269202MA1MR025.AA3S. mansoni adult Lambda Zap


Date: 11:32:5 on Fri 24 Nov 117.