EST 910206 is a singleton


Sequence

>910206 (1 EST) Length=161 AAACACTTTTTTTTTCTTTTTATCGCTTGAAATATCCAATTATTTTTTGTTTCTCAATGATATTGTATCTAAATAATTTA TCTTGATATACTTGTAAAATGTAAACTTTATTAATATGCATATAGCATATTATTGTTATATATATTTTATACAGATCATT C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910206: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102061906271AA269203MA1MR026.AA3S. mansoni adult Lambda Zap


Date: 2:28:24 on Mon 20 Nov 117.