EST 910210 is a singleton


Sequence

>910210 (1 EST) Length=192 CGTCTCAAGATCAACATCATACCCAACATCTGATTTCGTATAATTTTTCGTTTCATTATTTGGATCGATTTTTAACTTAC CTAATCACATTACAAGTATGTGGATAATATTTTCCAACTGCTGAATTGTTTAAAATAAGCCACATGTTATAAATGCCTTT TGAAACACTCAAGCGCCAATCTCAACTACACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910210: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102101906275AA269207MA1MR055.AA3S. mansoni adult Lambda Zap


Date: 9:5:24 on Tue 21 Nov 117.