EST 910214 is a singleton


Sequence

>910214 (1 EST) Length=208 CAGTAAATGGGGTGCAGGATTATCAGTTGCTTTTCTCATTTTACTATTGGTTGGACCAATTAACTTATTTCTAGGTTCAT CATTATTGGAATTATGTATGGCAGCCGGTGGTGCTTGTCTATTCAGTTTATTCATAGTTTATGATACTTGGCGAATAATG CATCATTGTTCACCGGAAGAATATATTATGGCATGCGTTGATCTATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910214: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102141906279AA269211MA1MR034.AA3S. mansoni adult Lambda Zap


Date: 19:47:43 on Fri 17 Nov 117.