EST 910224 is a singleton


Sequence

>910224 (1 EST) Length=179 TAAGGTTGTAGTAAGTTATCACGCGTCTGTTGAAAACATGGCTCTTGGTTGTGGGTATAAGTGTTTGCAGTGTTTGCTAA TTATTTTCAACTGTGGAGCATTCATATGTGGTCTCGGGCTGATTGTGGTTGNTGCACTTGGGCTCCATTCTGTTGTAAAT CACTGGAGCGAAATTGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910224: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102241906289AA269221MA1MR044.AA3S. mansoni adult Lambda Zap


Date: 16:12:32 on Tue 21 Nov 117.