EST 910225 is a singleton


Sequence

>910225 (1 EST) Length=194 TCTATATTGAATACTAGTTATCTACCAATTGAAGCTTATTATTCTGTTAAATCATGTTATATCGCTCCAAAAGCTTCCAT ATTGATAGATAATGGTAAACCAAATGAATCATTCTATCATCCACAAAACTTATTGCTCTATCCAGTAGAATTATATACCA TCAAAACAATTATATACTACTCATTATTGTCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910225: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102251906290AA269222MA1MR045.AA3S. mansoni adult Lambda Zap


Date: 9:20:27 on Sun 19 Nov 117.