EST 910227 is a singleton


Sequence

>910227 (1 EST) Length=193 CAACTGTTGTAGGACGTAGAGCTGTTAGTCAAGTGGTTTTATCACGAATATTAATGGCTTCTCCTGGAATGACAATTACC TTTTATGATCGAATCATTAGAAAGACAAAAATTACTTATNCGTTATCCTTGGTTAGGAGCTCCAATACAAATTAGTTTAG TCGGTTTGATGTTATCACTTGTAAAACCCCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910227: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102271906292AA269224MA1MR047.AA3S. mansoni adult Lambda Zap


Date: 5:58:8 on Sun 19 Nov 117.