EST 910230 is a singleton


Sequence

>910230 (1 EST) Length=136 TGAATACCATTTCTCCAAATAATAAAAGACATTTAACTAACATTCAATTAAAATAATGAATTAAAGTTAGTTTATGTTCT AATTCAGATAAAGTGTATTTTGTATGGTGGTGTGTATCGTTTCGTGATAGGCTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910230: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102301906295AA269227MA1MR050.AA3S. mansoni adult Lambda Zap


Date: 2:26:23 on Thu 23 Nov 117.