EST 910232 is a singleton


Sequence

>910232 (1 EST) Length=120 TATTCTTAATCCACAACAACAATTACCTGATATGAGTGAATTCCTTTCGTCACTGTCTTTATTTGGTGGAAATACTAAGA AGACCAATCCAACGGCGATAAATAAACGAAAATCTTTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 910232: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102321906297AA269229MA1MR053.AA3S. mansoni adult Lambda Zap


Date: 6:7:25 on Wed 22 Nov 117.