EST 910236 is a singleton


Sequence

>910236 (1 EST) Length=180 GCCATTTGCACTCAGCTAGCCTAAGCTGCTATAATTCGGTGACATTTGAAACGAATGGTACTAGGCTTGAGTTCGAAGTG AACATCAACTACTGAAGCACAGGTATATTCGCTGACAAGCCTAACTAGAGAGAAATACATACTCTAGATTTACTACTACT AGCATATATCTGTAAGATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910236: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102361906700AA269233MA1AS002.AASS. mansoni adult Lambda Zap


Date: 9:18:48 on Sun 19 Nov 117.