EST 910237 is a singleton


Sequence

>910237 (1 EST) Length=151 ACAGAACTATAGTGGGCAGCGTCGGAAAAACCTACAAGAACTATCTTAGATTACTCAAGAGGAAAGTGAGAAAGTTTTTA TGTGACCTAGCAGTAAAGTTGATAACTATGCAGTGTAGAAGAAGTAAAGACGTAGAGTCGCGGTCTTTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910237: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102371906701AA269234MA1AS004.AASS. mansoni adult Lambda Zap


Date: 3:49:20 on Sun 19 Nov 117.