EST 910238 is a singleton


Sequence

>910238 (1 EST) Length=183 GTGTAAATTATACTATCATATTCGAGACATTTTTACCGTTTATTAAAATTTAAAAGATAATGATTTCCTGTGATAGTTAT ACGAAAACCGTGAATTGAATTAAATACACTTAGTGTAGGCAACTATACGATATAGTGATCACACAGGAGGTGGGAAGAGT GCGTCGGCAACGGAGGGACAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910238: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102381906702AA269235MA1AS003.AASS. mansoni adult Lambda Zap


Date: 0:34:59 on Sat 25 Nov 117.