EST 910241 is a singleton


Sequence

>910241 (1 EST) Length=166 TTCACCTTAGTAAAAGTACNCCCTCTATCCAATAAGTACACTTTGTTCCTTGATCCTCCTGTCCTAGCGTTTTCCTTAAG CTTCCTTTTACTTAGAACTAACTAGCTAAAGGTTGATTGGCCATAAATTTGAAGAAAAAATGTACTTAAAACAACTTTCG TTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910241: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102411906705AA269238MA1AS007.AASS. mansoni adult Lambda Zap


Date: 17:20:6 on Fri 24 Nov 117.