EST 910242 is a singleton


Sequence

>910242 (1 EST) Length=211 AAGCAAATAATACTGGTAATAATAGTTTGTTAAAGGTAACAAGACGTATGCATGAAGGTAGTCTAAAAATGTCTTTCTTT ATTCTAAAGAGACGACTTTCAATAACAAGGTTGAAAACAACTAGTTAAGAACTAGAAACTAAAGATTAGTAAATATTTCG AAAACCCTAAAAAAATATATAGAATAAGTAGCTATTTTAACTAAATAGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910242: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102421906706AA269239MA1AS008.AASS. mansoni adult Lambda Zap


Date: 12:50:31 on Tue 21 Nov 117.