EST 910244 is a singleton


Sequence

>910244 (1 EST) Length=192 GTTTTCTCTACCTGTGATTTTCTACTTTACACCTTGCTATTACCTATATACTTCTTTTTAAAGCCTTTACAACAAAATTG CTTTACAGTTCGCTAATAGTTTATTATTATTTTGTTTTTTTGACTCAATCTCTTTCTTAAGACTAAGATATATATATAGT TGGAAACGCGACTTTAATTAGATAAGCACACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910244: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102441906708AA269241MA1AS010.AASS. mansoni adult Lambda Zap


Date: 22:54:12 on Wed 22 Nov 117.