EST 910247 is a singleton


Sequence

>910247 (1 EST) Length=229 GATCAGAAGCAATTAATAGGATTCGATTTAGTAGTATGTCTCATTTTATCAAGAGAAATTTGTATAGAAAATATAAAATA TAAAACTACTTGGCAAGTGTTAGTTGGCAAGAATTTTGTGGGTAAATCATTGTGTTATATTTTAACTTGTAGTTTAAATA AAACACTGTTAACAATCAAGTTAATTACAACTGTTCCGATTTGTCAATCCATATACTCCTAGATCACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910247: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102471906711AA269244MA1AS013.AASS. mansoni adult Lambda Zap


Date: 21:24:59 on Fri 24 Nov 117.