EST 910250 is a singleton


Sequence

>910250 (1 EST) Length=147 GGCGCACCAAATGAAATTCGACGAGTAGATTGTCAGTTTGGCTCGGGTTATTCTGACGGAATAGTATTTCTGCATCAAGG GAATACCAAGGTGATTGCATCCGTGGTTGGCCCATGCTCCTAGAGTAAAGTATGTACTCAAGAGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910250: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102501906714AA269247MA1NE002.AASS. mansoni adult Lambda Zap


Date: 2:37:43 on Mon 20 Nov 117.