EST 910255 is a singleton


Sequence

>910255 (1 EST) Length=161 CTGTGGCAATAATTCGAATTTAAAACGTTTACCTACTGATTTATCTGCGTCTGTTAATTCAGACCCCTCAACAGAGTTCA CCCGCTGCAAAAAAATTACGNAAATGACACACCATCCGGTACATCAACAATTTCAACGTACAAGTAATTGACTAAATACG T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910255: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102551906719AA269252MA1NE007.AASS. mansoni adult Lambda Zap


Date: 19:10:48 on Fri 24 Nov 117.