EST 910257 is a singleton


Sequence

>910257 (1 EST) Length=127 GGGGCGATATGCTCACGGAGCTGAACTTTAAAGCTNAAATGTATGTGTTATTAGGTGGACCAACTTCCTTATTTCAAAAA CCGATCTATTGATACAACTTTCGCTAAGCACAATTGTCAAATCCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910257: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102571906721AA269254MA1NE010.AASS. mansoni adult Lambda Zap


Date: 6:4:30 on Wed 22 Nov 117.