EST 910258 is a singleton


Sequence

>910258 (1 EST) Length=117 ATGGCTCATTTGATGGCGATTAAAGGTTATTGAACTTCACCAATTCCTTTTTTTCCCCAATTACTCTATCATTCTTATCA AATCAAAACGCTAAACCTAACTCATTAAACAAAACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910258: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102581906722AA269255MA1NE009.AASS. mansoni adult Lambda Zap


Date: 9:49:21 on Thu 23 Nov 117.