EST 910259 is a singleton


Sequence

>910259 (1 EST) Length=186 TACCAAACCAAACAGATACATATTGGTAGCCACAGTTTGCTCTAAGGAGGCGAAAGTTGCCAGAGCTTTTGCCTGTCCAG CGATTCTTCAAACCATGTGACTACCAACGATATACGCCACACCGACTGGAATCTAAATTCGTCTGTTACAGACTGCACTC ACTAACTGTCCAAACAATCATTCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910259: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102591906723AA269256MA1MA066.ADIS. mansoni adult Lambda gt11


Date: 9:45:7 on Thu 23 Nov 117.