EST 910261 is a singleton


Sequence

>910261 (1 EST) Length=195 TCCGACAATGATGCCTCTTCCGTATTTTCAAATGAATCCTTCCATCAGTTTAACTTAACAAATCAAACCTCTGATAAAAC AGAGGATAGAAATACTAATGGAGAAAAACATTCCACAGAATCAGTAAATCATATTTCGAATTTTACCTGTCAAAGTAGAA AAACTGAAATACCGGGTGTACATATAACAGGATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910261: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102611906725AA269258MC1MA068.AEIS. mansoni cercarial Lambda gt11


Date: 16:25:42 on Sat 18 Nov 117.