EST 910262 is a singleton


Sequence

>910262 (1 EST) Length=158 GTGTCATATAGAAGAATCAGAGGCGACTTATTACAGTTTTCAAATTGCTTAATGACAATTTGCACCCTGATATGCCTCAT TTTCTTGTCTTCAAACAGAAATCTACGGCACTCTAAAAGTCACAGCACGACGATACTGTCAGCTGCTACGCTTCACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910262: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102621906726AA269259MC1MA069.AEIS. mansoni cercarial Lambda gt11


Date: 23:0:51 on Wed 22 Nov 117.