EST 910264 is a singleton


Sequence

>910264 (1 EST) Length=176 TTACTGACTGAAGCCAAACGGCTACAAATTGAGCTTGAATCAACTTTGGAAGCTGAGAAGAAAGATTTGGATATCCGAGT TCAAACCGAGAATCAAACAGAGCCGCCTATTCACTTCAAACCATTAGGAAGCACACATTAGGAGCACACATTAGCGCGGC TCATTACAGCATTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910264: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102641906728AA269261MC1MA071.AEIS. mansoni cercarial Lambda gt11


Date: 23:40:27 on Fri 17 Nov 117.