EST 910266 is a singleton


Sequence

>910266 (1 EST) Length=167 GATGACGTGCCAAGCACATCCGACAAGTAGATGGAGGTTCATTTGAGCTGCATCTTTAGATGAGGCATCACATGATGATA ATAAATCGGAACACAGTGATTACATGCATGTGCATCATATCGGTGCAGTGGTCTGAGCTAGGCTCGTTGCTACATACTAG AGCTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910266: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102661906730AA269263MC1MA073.AEIS. mansoni cercarial Lambda gt11


Date: 3:51:44 on Sun 19 Nov 117.