EST 910267 is a singleton


Sequence

>910267 (1 EST) Length=185 CATGAAGCCAAAGAGCATTCACATCGATCTGAACACTGTCGAAAGACTTCACGACAAGATGCTGCTGTCATGGATTCATG ACACGAGCACACATTGTGAATGCTTGATAACAGATGAAGATAGCGTGTCATATATATATACAGACTTCTAGATAGTTCAT CAATATTCTTAATACTACACAGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910267: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102671906731AA269264MC1MA074.AEIS. mansoni cercarial Lambda gt11


Date: 4:34:25 on Thu 23 Nov 117.