EST 910268 is a singleton


Sequence

>910268 (1 EST) Length=218 TATCCAATATATTCTGTACATAAGATGCAATTAACCGACAAGTCAAAGCCATCGGTCATCAGATTCATCATCAGAACTGT TCGGCTCGTTGCAGTCTTACGGTCGACACACGCGTGCTGCACGGGCGACGTCGGCGCGACGACGGCGCACACAGAGGCAG CAGCCATGCATCATAGATCGCTCATGCTGCTCAGGCGTCAAGTGAGTAGATACACTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910268: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102681906732AA269265MC1MA075.AEIS. mansoni cercarial Lambda gt11


Date: 17:59:50 on Tue 21 Nov 117.