EST 910270 is a singleton


Sequence

>910270 (1 EST) Length=168 CTAGCTGCAACCTCAGTCAGTGATGGACTAGCTCGACCTATGAGATGTGTGAGCACTTGATCAGAGTACATACTATTACT CAAACTATGTCACGGCGCATCAACTAGGATGACAGGCTGTAGCGTATTTCAGCTGGTACGTATTACTTCATCAGACAGTT GACATCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910270: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102701906734AA269267MC1MA077.AEIS. mansoni cercarial Lambda gt11


Date: 0:3:24 on Sun 19 Nov 117.