EST 910271 is a singleton


Sequence

>910271 (1 EST) Length=180 TGAGCTCGGTGCTAGGCTAACGCAGTAGGGCTTAGTGGTCTTGGTGCAAGAATTTGCCATTCGGTAGTTGGTGATGCTGG TGTACGTGCACAGCTCAACAATCCAGGCTATTCGTAGGGATGGTGCTCATCTACATTTCGCGAAGTCTCGGTCTTACGTT AATTGTCGTCTTATTTGTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910271: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102711906735AA269268MC1MA078.AEIS. mansoni cercarial Lambda gt11


Date: 11:7:4 on Tue 21 Nov 117.