EST 910272 is a singleton


Sequence

>910272 (1 EST) Length=167 TTTCTACGCCGGACGTGCAAACAGATGTAAATACACTGAACTCAGAAGTGTATGTCCACCGTCAAGTAACTCTGCTGACG TGTACACTACGCGAGCACTATGAAGCTCTCTACACTACTCGGACATGCTCATAGCCTGTCTACTATTGCATCAGTATACG AGCAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910272: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102721906736AA269269MU1MA079.ALSS. mansoni Schistosomule Lambda Zap


Date: 15:35:6 on Fri 24 Nov 117.