EST 910274 is a singleton


Sequence

>910274 (1 EST) Length=166 AACAAAATAGAACACTGTAAGTCCTATTTCATCTCACTATACACGAGTCGGCAAGGTAAATATTGTGTCAAGAGGCACAT GAGGTCTTCCTTTAGCATGCAACGTGCAAAATCTCGTTCAAACGTAAATGCATATGCACTGTCCCGATCGCTCTGCACGA CGCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910274: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102741906738AA269271MU1MA081.ALSS. mansoni Schistosomule Lambda Zap


Date: 13:16:29 on Wed 22 Nov 117.