EST 910275 is a singleton


Sequence

>910275 (1 EST) Length=168 AACCAAAATCACCAATTTCAGTTCCCGGTTCACTGAATAAAGTCAAAGAAACAATGATAGCAGTCGTGTTTCCATTTAGC GCTCGTGACTACCTGCAAGCTAGCCATGGCAGCCGACCTAGACATCAATACATCATGCTATCGTCCAAGCTAGTCTAGCT AGCTTAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910275: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102751906739AA269272MU1MA082.ALSS. mansoni Schistosomule Lambda Zap


Date: 12:39:58 on Fri 17 Nov 117.