EST 910277 is a singleton


Sequence

>910277 (1 EST) Length=184 CAATTCGACGCTCGAACCTGCTTCTTCCCACTGGTGAACCACTTGTCTACCATCCGTCGTGTCCTGTCACAGCCTTCCTC ACTTGGAAGTATTAGCTGACTCACCGACTCAAGATCCTGCGACATTGTGTGTTACATATCACCTTATGGCAATCGACTTG CAATGCCGACATTGCCAAGCTACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910277: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102771906741AA269274MU1MA084.ALSS. mansoni Schistosomule Lambda Zap


Date: 13:38:34 on Fri 24 Nov 117.