EST 910278 is a singleton


Sequence

>910278 (1 EST) Length=173 ATACCGGGACTCAATGTGGAGGACGTCCGTAATTACCGCACATCGTAGGTACAAATATGTCAAATAATTCCATCTTAAAC GGAGAGACACAAATGTAGAGACTGGAGACAAGCATGGTGCCAGCAGACTGCCGGATGATAGCATACCAAGGCGTACTCTA AGACACGCAGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910278: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102781906742AA269275MU1MA085.ALSS. mansoni Schistosomule Lambda Zap


Date: 18:57:35 on Thu 23 Nov 117.